Nietolerancja ortostatyczna i tachykardia związana z niedoborem nośnika norepinefryny cd

U matki i całego rodzeństwa, z wyjątkiem jednej siostry, ciśnienie krwi i częstość akcji serca określano w pozycji leżącej na plecach i po 5 minutach odstawienia, a katecholaminy w osoczu mierzono po tym, jak badani byli w pozycji leżącej przez 20 minut, a następnie po stojąc przez 30 minut. Wykrywanie mutacji
Amplifikację i sekwencjonowanie przeprowadzono w Vanderbilt Center for Molecular Neuroscience DNA Sequencing Core. Genomowy DNA wyizolowano z krwi żylnej za pomocą zestawu do ekstrakcji DNA PureGene (Gentra Systems, Minneapolis), a eksony ludzkiego genu transportera norepinefryny (SLC6A2, McKusick nr 16397014) zamplifikowano za pomocą reakcji łańcuchowej polimerazy i sensu i startery antysensowne (sekwencje oligonukleotydów stosowanych w reakcji łańcuchowej eksonowej polimerazy i warunki amplifikacji są dostępne na żądanie). Zamplifikowane produkty (60 ng na próbkę) sekwencjonowano bezpośrednio za pomocą terminatorów łańcucha fluorescencyjnego dideoksynukleotydu (AmpliTaq FS, Perkin Elmer Applied Biosystems, Foster City, CA) na zautomatyzowanym sekwenatorze DNA (ABI 310, Perkin Elmer Applied Biosystems).
Analiza funkcjonalna zidentyfikowanej mutacji
DNA kodujący ludzki transporter norepinefryny alaniną zastąpioną przez prolinę w pozycji 457 (Ala457Pro) utworzono za pomocą zestawu (QuikChange Site-Directed Mutagenesis Kit, Stratagene, La Jolla, CA) z oligonukleotydami 5 CCTTCAGTACTTTCCTTCTCCCCCTGTTCTGCATAACCAAG3 i 5 CTTGGTTATGCAGAACAGGGGGAGAAGGAAAGTACTGA-AGG3 . Podkreślone zasady to te, które wprowadzono w celu utworzenia mutacji, w której guaninę zastąpiono cytozyną w pozycji 237 (G237C) lub wprowadzono miejsce restrykcyjne ScaI, które można zastosować do identyfikacji zmutowanych plazmidów. Amplifikowane DNA klonowano do konstruktu (pcDNA3, Invitrogen, Carlsbad, CA), zawierającego ludzki komplementarny DNA (cDNA) transportera dzikiego typu norepinefryny, w którym mutacja cicha lub taka, która nie powoduje zmiany aminokwasu (w w tym przypadku leucyna w pozycji 438) została wcześniej wprowadzona w celu stworzenia unikalnego miejsca restrykcyjnego Afl II, a zatem ułatwienia subklonowania zmutowanej sekwencji z powrotem do konstruktu typu dzikiego. Subklonowany region sekwencjonowano oligonukleotydami transportera norepinefryny 5 CATTCT-GGGCTGTTGTGT3 i 5 GTGGTTGTGGTCAGCATCATC3 . DNA z wielu izolatów zmutowanych klonów oczyszczono (Qiagen, Santa Clarita, CA), aby zbadać wpływ mutacji Ala457Pro na aktywność transportera.
Transporter norepinefryny typu dzikiego, transporter norepinefryny z mutacją Ala457Pro i plazmidy pcDNA3 przejściowo transfekowano do komórek jajnika chomika chińskiego (American Type Culture Collection, Rockville, MD) przy użyciu lipofektaminy. Komórki testowano na trytowaną aktywność transportera norepinefryny (20 nmoli na litr) 72 godziny po transfekcji, jak opisano wcześniej.15
Genotypowanie alleli Ala457Pro
Hybrydyzację oligonukleotydową specyficzną dla allelu stosowano do testowania obecności mutacji Ala457Pro, z hybrydyzacją 5 CCTTCTCGCCCTGTT3 do allelu typu dzikiego i hybrydyzacji 5 CCTTCTCCCCCTGTT3 ze zmutowanym allelem.
[przypisy: nerw okoruchowy, nerw strzałkowy powierzchowny, falvit forum ]
[przypisy: babka plesznik, gratka yorki, babka płesznik opinie ]