Pielęgnowanie ogrodu Adama ad

Innymi słowy, układ odpornościowy reaguje na własną reakcję. Jak przekonywał Niels Jerne w latach siedemdziesiątych, wzorzec poznania, a nie jakaś prosta zmiana typu on-off, ma krytyczne znaczenie dla zdolności reagowania. Tak więc, tak jak szyszki siatkówki wyczuwają tylko trzy kolory, tak samo trzy typy immunocytów tworzą system poznawczy, który postrzega, przetwarza i działa na podstawie informacji. Pozorne wady braku jednoznacznej specyficzności antygenu i receptora są według Cohena rozwiązaniem dla zachowania immunologicznego. W jego schemacie degeneracja i plejotropizm stają się zasadniczą cechą konstrukcji wzorców immunologicznych. Continue reading „Pielęgnowanie ogrodu Adama ad”

Wielolekooporna Salmonella enterica Serotyp Typhimurium DT104

M.lbak i in. (4 listopada) zwracają uwagę na rozbieżności między wynikami badań in vitro wrażliwości na ciprofloksacynę u salmonelli a niepowodzeniem leczenia. Ewolucja odporności na antybiotyki najczęściej występuje in vivo, a niektóre czynniki odporności mogą być promowane przez to środowisko. Ekscytujące wyniki pojawiły się po zastosowaniu technologii ekspresji in vivo (IVET) do odkrycia czynników wirulencji.2 W wielu z tych eksperymentów oporność na antybiotyki została wykorzystana jako mechanizm raportujący ekspresję genów związanych z IVET. Takie podejście może zaciemnić możliwość, że sama oporność może czasami być z natury ograniczonym in vivo czynnikiem wirulencji. Continue reading „Wielolekooporna Salmonella enterica Serotyp Typhimurium DT104”

Metronidazol zapobiega przedwczesnemu porodowi u kobiet w ciąży z bezobjawową bakteryjnym zakażeniem pochwy cd

Podczas randomizacji pobierano próbki pochwy do pomiaru pH, barwienia Grama i hodowli T. vaginalis; wyniki zostały zgłoszone do biostatystycznego ośrodka koordynującego, ale nie do miejsca badań klinicznych. Po uzyskaniu tych próbek kobiety losowo przydzielono w sposób podwójnie ślepy, aby otrzymać osiem kapsułek, z których każda zawierała 250 mg metronidazolu lub placebo z laktozą. Kapsułki przygotowano przez umieszczenie w kapsułce ogólnej tabletki metronidazolowej lub tabletki placebo i wypełnienie pozostałości laktozą, aby miały identyczny wygląd. Kapsułki zostały spożyte w obecności personelu badawczego. Continue reading „Metronidazol zapobiega przedwczesnemu porodowi u kobiet w ciąży z bezobjawową bakteryjnym zakażeniem pochwy cd”

Nietolerancja ortostatyczna i tachykardia związana z niedoborem nośnika norepinefryny cd

U matki i całego rodzeństwa, z wyjątkiem jednej siostry, ciśnienie krwi i częstość akcji serca określano w pozycji leżącej na plecach i po 5 minutach odstawienia, a katecholaminy w osoczu mierzono po tym, jak badani byli w pozycji leżącej przez 20 minut, a następnie po stojąc przez 30 minut. Wykrywanie mutacji
Amplifikację i sekwencjonowanie przeprowadzono w Vanderbilt Center for Molecular Neuroscience DNA Sequencing Core. Genomowy DNA wyizolowano z krwi żylnej za pomocą zestawu do ekstrakcji DNA PureGene (Gentra Systems, Minneapolis), a eksony ludzkiego genu transportera norepinefryny (SLC6A2, McKusick nr 16397014) zamplifikowano za pomocą reakcji łańcuchowej polimerazy i sensu i startery antysensowne (sekwencje oligonukleotydów stosowanych w reakcji łańcuchowej eksonowej polimerazy i warunki amplifikacji są dostępne na żądanie). Zamplifikowane produkty (60 ng na próbkę) sekwencjonowano bezpośrednio za pomocą terminatorów łańcucha fluorescencyjnego dideoksynukleotydu (AmpliTaq FS, Perkin Elmer Applied Biosystems, Foster City, CA) na zautomatyzowanym sekwenatorze DNA (ABI 310, Perkin Elmer Applied Biosystems).
Analiza funkcjonalna zidentyfikowanej mutacji
DNA kodujący ludzki transporter norepinefryny alaniną zastąpioną przez prolinę w pozycji 457 (Ala457Pro) utworzono za pomocą zestawu (QuikChange Site-Directed Mutagenesis Kit, Stratagene, La Jolla, CA) z oligonukleotydami 5 CCTTCAGTACTTTCCTTCTCCCCCTGTTCTGCATAACCAAG3 i 5 CTTGGTTATGCAGAACAGGGGGAGAAGGAAAGTACTGA-AGG3 . Continue reading „Nietolerancja ortostatyczna i tachykardia związana z niedoborem nośnika norepinefryny cd”

Komórki cytokeratynowe w szpiku kostnym i przeżycie pacjentów z rakiem piersi w stadium I, II lub III czesc 4

Pierwszorzędowym punktem końcowym było przeżycie mierzone od daty operacji do czasu ostatniej wizyty kontrolnej lub śmierci związanej z rakiem. Drugorzędowymi punktami końcowymi były: nawrót lokoregionalny (w tym nawroty w piersiach ipsilateralnych i przeciwstronnych) oraz odległe przerzuty i były mierzone w taki sam sposób jak pierwotny punkt końcowy. Skonstruowaliśmy krzywe tablicowe Kaplan-Meier dla przeżycia wolnego od miejscowych i odległych nawrotów i całkowitego przeżycia.25 Użyliśmy testu log-rank do porównania pacjentów z mikroprzerzutami szpiku kostnego z tymi bez mikroprzerzutów. Dane dotyczące pacjentów, którzy żyli i nie mieli dowodów choroby pod koniec naszego badania, zostały ocenzurowane. Do oszacowania efektu prognostycznego różnych zmiennych wykorzystaliśmy analizę proporcjonalnego hazardu Coxa. Continue reading „Komórki cytokeratynowe w szpiku kostnym i przeżycie pacjentów z rakiem piersi w stadium I, II lub III czesc 4”

Macierz zewnątrzkomórkowa sprzyja wzrostowi i różnicowaniu mysich komórek krwiotwórczych in vitro.

Opracowaliśmy długoterminowy system hodowli, w którym komórki mysiego szpiku są hodowane na złożonej macierzy zewnątrzkomórkowej (ECM), która pochodzi ze szpiku i ekstrahowana chlorowodorkiem guanidyny i ditiotreitolem. Hodowle szpiku zostały ustalone ze świeżymi komórkami mysiego szpiku i naładowane po 2 tyg. (Tydzień 0). Mikroskopia fazowa wykazała znacznie zwiększony rozwój warstwy adherentnej na ECM w porównaniu z kontrolami w ciągu tygodnia po doładowaniu. Dzięki mikroskopii elektronowej ta warstwa adhezyjna składała się z licznych komórek siatkowatych najwyraźniej przyczepionych do ECM, które rozszerzały projekcje cytoplazmatyczne do otaczających komórek hematopoetycznych. Continue reading „Macierz zewnątrzkomórkowa sprzyja wzrostowi i różnicowaniu mysich komórek krwiotwórczych in vitro.”

Sn-protoporfiryna szybko i znacząco zwiększa nasycenie hemu wątrobowej pirotazy tryptofanowej. Dowód, że ta syntetyczna metaloporfiryna zwiększa funkcjonalną zawartość hemu w wątrobie.

Sn-protoporfiryna jest silnym konkurencyjnym inhibitorem hemowej oksygenazy, enzymu ograniczającego szybkość degradacji hemu do pigmentu żółciowego i została z powodzeniem wykorzystana do supresji hiperbilirubinemii w różnych doświadczalnych i występujących naturalnie formach żółtaczki u zwierząt i ludzi. Uważa się, że związek działa in vivo głównie poprzez hamowanie utleniania hemu; zatem można rozsądnie oczekiwać, że zachowanie części funkcyjnej hea komórkowego z degradacji za pomocą hemowej oksygenaz nastąpi po podaniu Sn-protoporfiryny. Zbadaliśmy to zagadnienie w wątrobie, badając wysycenie hemu wysyconego pirolazą tryptofanu, enzymu zależnego od hemu, który kontroluje pierwszy i ograniczający szybkość etap w katabolizmie L-tryptofanu. Sn-protoporfiryna, w dawkach (10 mumol / kg mc.), Które całkowicie tłumią hiperbilirubinemię u noworodków u zwierząt doświadczalnych, prowadzi do bardzo szybkiego (w przybliżeniu 30-60 min) wzrostu wysycenia pirogazą tryptofanu w hemie z normalnych poziomów około 50 -60% do prawie 100%. Efekt osiąga wartości szczytowe po 1-2 godzinach i utrzymuje się przez co najmniej 12 godzin. Continue reading „Sn-protoporfiryna szybko i znacząco zwiększa nasycenie hemu wątrobowej pirotazy tryptofanowej. Dowód, że ta syntetyczna metaloporfiryna zwiększa funkcjonalną zawartość hemu w wątrobie.”

Badania nad mechanizmem supresji hiperbilirubinemii przez Sn-protoporfiryna. Hamowanie utleniania hemu i produkcji bilirubiny.

Syntetyczny analog hemu, protoporfiryna, jest silnym konkurencyjnym inhibitorem hemowej oksygenazy, enzymu ograniczającego szybkość degradacji hemu do pigmentu żółciowego i może całkowicie tłumić hiperbilirubinemię u noworodków oraz znacząco obniżyć poziom bilirubiny w osoczu w różnych okolicznościach u zwierząt doświadczalnych. i człowiek. Aby dokładniej zbadać mechanizm, za pomocą którego metaloporfiryna zmniejsza poziom bilirubiny in vivo, zbadaliśmy jej wpływ na wytwarzanie bilirubiny u szczurów z kaniulą dróg żółciowych, w której wiadomo, że bilirubina pochodząca z katabolizmu hemu jest szybko wydalana z żółcią. Po podaniu Sn-protoporfiryny (10-50 mumoli / kg masy ciała) następowało szybkie (w ciągu około godziny) i utrzymujące się (do co najmniej 18 godzin) zmniejszenie wydajności bilirubiny do poziomów 25-30% poniżej poziomów wydajności bilirubiny u zwierząt z przetoką kontrolną. Metaloporfiryna nie miała wpływu na przepływ żółci ani na wydzielanie żółci z kwasów żółciowych. Continue reading „Badania nad mechanizmem supresji hiperbilirubinemii przez Sn-protoporfiryna. Hamowanie utleniania hemu i produkcji bilirubiny.”

Biomsynteza porfiryn-hem w organotypowych hodowlach zwojów korzeni grzbietowych myszy. Wpływ hemu i ołowiu na syntezę porfiryny i mielinę obwodową.

Dobrze mielinizowane kultury mysich zwojów korzonków grzbietowych inkubowane przez 48 godzin z kwasem sigma-aminolewulinowym (ALA) wykazywały intensywną fluorescencję porfiryny umiejscowioną w osłonkach mielinowych, ale nie w aksonach ani somaksie neuronalnym. Gdy hodowle były w sposób ciągły inkubowane z wysoką zawartością ołowiu, ogniskowe obrzęki i segmentalne zwyrodnienie mieliny zaczęły się rozwijać w ciągu 2 wk. Inkubacja kultur za pomocą ALA po 3 tyg. Leczenia ołowiowego wykazała znacznie zmniejszoną fluorescencję porfiryny w osłonkach mielinowych w porównaniu z nieleczonymi kontrolami. Po 6 tygodniach leczenia ołowiem mielina wykazała ciężką degenerację odcinka. Continue reading „Biomsynteza porfiryn-hem w organotypowych hodowlach zwojów korzeni grzbietowych myszy. Wpływ hemu i ołowiu na syntezę porfiryny i mielinę obwodową.”

Rozkłady środka powierzchniowo czynnego i płucnego po leczeniu przedwczesnych jagniąt naturalnym surfaktantem.

Przedwcześnie urodzone jagnięta traktowano znakowanym radioaktywnie naturalnym środkiem powierzchniowo czynnym przez wkroplenie tchawicy przy urodzeniu i przed rozpoczęciem mechanicznej wentylacji lub po 23 +/- (+/- SE) min wentylacji mechanicznej. Prawidłowe rozkłady przepływu krwi w komorze, wyniki lewej komory i boczne przecieki kanału od lewej do prawej mierzono radioznakowanymi mikrosferami. Po uśmierceniu płuca jagniąt otrzymujących w chwili porodu środek powierzchniowo czynny napompowywano równomiernie z ciągłym naciskiem, podczas gdy płuca jagniąt traktowane po okresie wentylacji miały napowietrzone, częściowo napowietrzone i niedodmujące obszary. Wszystkie płuca zostały podzielone na części, które zostały zważone i skatalogowane pod względem lokalizacji. Oznaczono ilość radioaktywnego środka powierzchniowo czynnego i radioaktywności związanej z mikrosferą w każdym kawałku płuca. Continue reading „Rozkłady środka powierzchniowo czynnego i płucnego po leczeniu przedwczesnych jagniąt naturalnym surfaktantem.”