Pielęgnowanie ogrodu Adama ad

Innymi słowy, układ odpornościowy reaguje na własną reakcję. Jak przekonywał Niels Jerne w latach siedemdziesiątych, wzorzec poznania, a nie jakaś prosta zmiana typu on-off, ma krytyczne znaczenie dla zdolności reagowania. Tak więc, tak jak szyszki siatkówki wyczuwają tylko trzy kolory, tak samo trzy typy immunocytów tworzą system poznawczy, który postrzega, przetwarza i działa na podstawie informacji. Pozorne wady braku jednoznacznej specyficzności antygenu i receptora są według Cohena rozwiązaniem dla zachowania immunologicznego. W jego schemacie degeneracja i plejotropizm stają się zasadniczą cechą konstrukcji wzorców immunologicznych. Continue reading „Pielęgnowanie ogrodu Adama ad”

Wielolekooporna Salmonella enterica Serotyp Typhimurium DT104

M.lbak i in. (4 listopada) zwracają uwagę na rozbieżności między wynikami badań in vitro wrażliwości na ciprofloksacynę u salmonelli a niepowodzeniem leczenia. Ewolucja odporności na antybiotyki najczęściej występuje in vivo, a niektóre czynniki odporności mogą być promowane przez to środowisko. Ekscytujące wyniki pojawiły się po zastosowaniu technologii ekspresji in vivo (IVET) do odkrycia czynników wirulencji.2 W wielu z tych eksperymentów oporność na antybiotyki została wykorzystana jako mechanizm raportujący ekspresję genów związanych z IVET. Takie podejście może zaciemnić możliwość, że sama oporność może czasami być z natury ograniczonym in vivo czynnikiem wirulencji. Continue reading „Wielolekooporna Salmonella enterica Serotyp Typhimurium DT104”

Metronidazol zapobiega przedwczesnemu porodowi u kobiet w ciąży z bezobjawową bakteryjnym zakażeniem pochwy cd

Podczas randomizacji pobierano próbki pochwy do pomiaru pH, barwienia Grama i hodowli T. vaginalis; wyniki zostały zgłoszone do biostatystycznego ośrodka koordynującego, ale nie do miejsca badań klinicznych. Po uzyskaniu tych próbek kobiety losowo przydzielono w sposób podwójnie ślepy, aby otrzymać osiem kapsułek, z których każda zawierała 250 mg metronidazolu lub placebo z laktozą. Kapsułki przygotowano przez umieszczenie w kapsułce ogólnej tabletki metronidazolowej lub tabletki placebo i wypełnienie pozostałości laktozą, aby miały identyczny wygląd. Kapsułki zostały spożyte w obecności personelu badawczego. Continue reading „Metronidazol zapobiega przedwczesnemu porodowi u kobiet w ciąży z bezobjawową bakteryjnym zakażeniem pochwy cd”

Nietolerancja ortostatyczna i tachykardia związana z niedoborem nośnika norepinefryny cd

U matki i całego rodzeństwa, z wyjątkiem jednej siostry, ciśnienie krwi i częstość akcji serca określano w pozycji leżącej na plecach i po 5 minutach odstawienia, a katecholaminy w osoczu mierzono po tym, jak badani byli w pozycji leżącej przez 20 minut, a następnie po stojąc przez 30 minut. Wykrywanie mutacji
Amplifikację i sekwencjonowanie przeprowadzono w Vanderbilt Center for Molecular Neuroscience DNA Sequencing Core. Genomowy DNA wyizolowano z krwi żylnej za pomocą zestawu do ekstrakcji DNA PureGene (Gentra Systems, Minneapolis), a eksony ludzkiego genu transportera norepinefryny (SLC6A2, McKusick nr 16397014) zamplifikowano za pomocą reakcji łańcuchowej polimerazy i sensu i startery antysensowne (sekwencje oligonukleotydów stosowanych w reakcji łańcuchowej eksonowej polimerazy i warunki amplifikacji są dostępne na żądanie). Zamplifikowane produkty (60 ng na próbkę) sekwencjonowano bezpośrednio za pomocą terminatorów łańcucha fluorescencyjnego dideoksynukleotydu (AmpliTaq FS, Perkin Elmer Applied Biosystems, Foster City, CA) na zautomatyzowanym sekwenatorze DNA (ABI 310, Perkin Elmer Applied Biosystems).
Analiza funkcjonalna zidentyfikowanej mutacji
DNA kodujący ludzki transporter norepinefryny alaniną zastąpioną przez prolinę w pozycji 457 (Ala457Pro) utworzono za pomocą zestawu (QuikChange Site-Directed Mutagenesis Kit, Stratagene, La Jolla, CA) z oligonukleotydami 5 CCTTCAGTACTTTCCTTCTCCCCCTGTTCTGCATAACCAAG3 i 5 CTTGGTTATGCAGAACAGGGGGAGAAGGAAAGTACTGA-AGG3 . Continue reading „Nietolerancja ortostatyczna i tachykardia związana z niedoborem nośnika norepinefryny cd”

Komórki cytokeratynowe w szpiku kostnym i przeżycie pacjentów z rakiem piersi w stadium I, II lub III czesc 4

Pierwszorzędowym punktem końcowym było przeżycie mierzone od daty operacji do czasu ostatniej wizyty kontrolnej lub śmierci związanej z rakiem. Drugorzędowymi punktami końcowymi były: nawrót lokoregionalny (w tym nawroty w piersiach ipsilateralnych i przeciwstronnych) oraz odległe przerzuty i były mierzone w taki sam sposób jak pierwotny punkt końcowy. Skonstruowaliśmy krzywe tablicowe Kaplan-Meier dla przeżycia wolnego od miejscowych i odległych nawrotów i całkowitego przeżycia.25 Użyliśmy testu log-rank do porównania pacjentów z mikroprzerzutami szpiku kostnego z tymi bez mikroprzerzutów. Dane dotyczące pacjentów, którzy żyli i nie mieli dowodów choroby pod koniec naszego badania, zostały ocenzurowane. Do oszacowania efektu prognostycznego różnych zmiennych wykorzystaliśmy analizę proporcjonalnego hazardu Coxa. Continue reading „Komórki cytokeratynowe w szpiku kostnym i przeżycie pacjentów z rakiem piersi w stadium I, II lub III czesc 4”

Macierz zewnątrzkomórkowa sprzyja wzrostowi i różnicowaniu mysich komórek krwiotwórczych in vitro.

Opracowaliśmy długoterminowy system hodowli, w którym komórki mysiego szpiku są hodowane na złożonej macierzy zewnątrzkomórkowej (ECM), która pochodzi ze szpiku i ekstrahowana chlorowodorkiem guanidyny i ditiotreitolem. Hodowle szpiku zostały ustalone ze świeżymi komórkami mysiego szpiku i naładowane po 2 tyg. (Tydzień 0). Mikroskopia fazowa wykazała znacznie zwiększony rozwój warstwy adherentnej na ECM w porównaniu z kontrolami w ciągu tygodnia po doładowaniu. Dzięki mikroskopii elektronowej ta warstwa adhezyjna składała się z licznych komórek siatkowatych najwyraźniej przyczepionych do ECM, które rozszerzały projekcje cytoplazmatyczne do otaczających komórek hematopoetycznych. Continue reading „Macierz zewnątrzkomórkowa sprzyja wzrostowi i różnicowaniu mysich komórek krwiotwórczych in vitro.”

Rozpoznanie P substancji przez podzbiór ludzkich limfocytów T.

Interakcje substancji P z limfocytami T ludzkiej krwi, które stymulują proliferację limfocytów T, określono ilościowo zarówno za pomocą cytometrii przepływowej, jak i testów bezpośredniego wiązania. W cytometrii przepływowej wykrywającej fluorescencję odnotowano wiązanie substancji znakowanej dichlorotriazynoamino-fluoresceiną P z 21 +/- 10% (średnia +/- SD, n = 6) i 35 +/- 8% (n = 2) z ludzką krwią T limfocyty przed i po stymulacji odpowiednio 10 mikrogramów / ml fitohemaglutyniny. Poddajniki supresorowo-cytotoksyczne (leu 2a) i pomocnicze indukujące (leu 3a) zidentyfikowane przez monoklonalne przeciwciała znakowane fikoerytryną zawierały limfocyty T-reaktywne wobec substancji o odpowiednich średnich częstotliwościach 10 i 18%. [3H] substancja P wiązała się szybko i odwracalnie ze średnią z 7035 +/- 2850 miejsc / limfocytów T, która wykazywała stałą dysocjacji (KD) 1,85 +/- 0,70 X 10 (-7) M (średnia +/- SD, n = 5). [D-Pro2, D-Phe7, D-Trp9] substancja P hamowała wiązanie substancji P znakowanej dichlorotriazynyloamino-fluoresceiną P i [3H] substancji P z limfocytami T w stężeniach, które hamowały odpowiedź proliferacyjną na substancję P. Continue reading „Rozpoznanie P substancji przez podzbiór ludzkich limfocytów T.”

Czynnik von Willebranda wiąże się z płytkami krwi i indukuje agregację typu płytkowego, ale nie typu IIB von Willebranda.

Choroba von Willebranda typu płytkowego (vWD) i pseudo-vWD to dwa ostatnio opisane wewnętrzne defekty płytek charakteryzujące się zwiększoną aglutynacją wywołaną ristocetyną w osoczu bogatopłytkowym. Podobne stwierdzenie jest również typowe dla typu IIB vWD, gdzie było ono związane z czynnikiem von Willebranda (vWF), a nie z nieprawidłowością płytek. Agregacja płytek indukowana niezmodyfikowanym ludzkim vWF przy braku innych bodźców była opisywana w pseudo-vWD. W tym badaniu wykazano, że vWF indukuje agregację w typie płytek krwi, ale nie w typie IIB vWD. Agregację obserwuje się, gdy normalne krioprecypitaty osocza lub oczyszczony vWF dodaje się do osocza bogatopłytkowego. Continue reading „Czynnik von Willebranda wiąże się z płytkami krwi i indukuje agregację typu płytkowego, ale nie typu IIB von Willebranda.”

Rozszczepianie i inaktywacja czynnika IX przez elastazę granulocytową.

Radioaktywowany radioaktywnie czynnik IX został rozszczepiony przez surowy sonik z leukocytów. W przypadku braku wapnia fragmenty o masie cząsteczkowej mniejszej niż 15 000 mol. Obserwowano w próbkach zredukowanych na elektroforezie żelowej. Po trawieniu w 2 mM wapnie, jednak elektroforeza zredukowanych próbek wykazała, oprócz fragmentów o niskiej masie cząsteczkowej, prążki białek odpowiadające wielkości ciężkim i lekkim łańcuchom czynnika IX aktywowanego przez czynnik XIa. Aktywność rozszczepiania w sonikatach leukocytów była hamowana przez inhibitor trypsyny sojowej, ale tylko w niewielkim stopniu przez aprotyninę. Continue reading „Rozszczepianie i inaktywacja czynnika IX przez elastazę granulocytową.”

Zmiana metabolizmu dihydrotestosteronu u starszych mężczyzn z rozrostem gruczołu krokowego.

Kinetykę androgenową in vivo określono u sześciu młodych (21-49 lat) i starszych mężczyzn (62-77 lat) z hiperplazją prostaty (BPH). Wlewki w stanie stacjonarnym [14C] testosteronu i [3H] androstanediolu (3 alfa diolu) zostały podane, co pozwoliło określić konwersje testosteronu prowadzi do dihydrotesteronu (DHT) w równowadze lub utworzonego z 3 alfa diolu. Wlewy te dostarczają również danych dotyczących klirensu metabolicznego, które wraz z oceną nieisotopowych stężeń steroidów, dają oszacowanie szybkości produkcji krwi. Szybkość produkcji testosteronu wynosiła 6,04 . 1,66 wobec 3,69 . Continue reading „Zmiana metabolizmu dihydrotestosteronu u starszych mężczyzn z rozrostem gruczołu krokowego.”