Pielęgnowanie ogrodu Adama ad

Innymi słowy, układ odpornościowy reaguje na własną reakcję. Jak przekonywał Niels Jerne w latach siedemdziesiątych, wzorzec poznania, a nie jakaś prosta zmiana typu on-off, ma krytyczne znaczenie dla zdolności reagowania. Tak więc, tak jak szyszki siatkówki wyczuwają tylko trzy kolory, tak samo trzy typy immunocytów tworzą system poznawczy, który postrzega, przetwarza i działa na podstawie informacji. Pozorne wady braku jednoznacznej specyficzności antygenu i receptora są według Cohena rozwiązaniem dla zachowania immunologicznego. W jego schemacie degeneracja i plejotropizm stają się zasadniczą cechą konstrukcji wzorców immunologicznych. Continue reading „Pielęgnowanie ogrodu Adama ad”

Wielolekooporna Salmonella enterica Serotyp Typhimurium DT104

M.lbak i in. (4 listopada) zwracają uwagę na rozbieżności między wynikami badań in vitro wrażliwości na ciprofloksacynę u salmonelli a niepowodzeniem leczenia. Ewolucja odporności na antybiotyki najczęściej występuje in vivo, a niektóre czynniki odporności mogą być promowane przez to środowisko. Ekscytujące wyniki pojawiły się po zastosowaniu technologii ekspresji in vivo (IVET) do odkrycia czynników wirulencji.2 W wielu z tych eksperymentów oporność na antybiotyki została wykorzystana jako mechanizm raportujący ekspresję genów związanych z IVET. Takie podejście może zaciemnić możliwość, że sama oporność może czasami być z natury ograniczonym in vivo czynnikiem wirulencji. Continue reading „Wielolekooporna Salmonella enterica Serotyp Typhimurium DT104”

Metronidazol zapobiega przedwczesnemu porodowi u kobiet w ciąży z bezobjawową bakteryjnym zakażeniem pochwy cd

Podczas randomizacji pobierano próbki pochwy do pomiaru pH, barwienia Grama i hodowli T. vaginalis; wyniki zostały zgłoszone do biostatystycznego ośrodka koordynującego, ale nie do miejsca badań klinicznych. Po uzyskaniu tych próbek kobiety losowo przydzielono w sposób podwójnie ślepy, aby otrzymać osiem kapsułek, z których każda zawierała 250 mg metronidazolu lub placebo z laktozą. Kapsułki przygotowano przez umieszczenie w kapsułce ogólnej tabletki metronidazolowej lub tabletki placebo i wypełnienie pozostałości laktozą, aby miały identyczny wygląd. Kapsułki zostały spożyte w obecności personelu badawczego. Continue reading „Metronidazol zapobiega przedwczesnemu porodowi u kobiet w ciąży z bezobjawową bakteryjnym zakażeniem pochwy cd”

Nietolerancja ortostatyczna i tachykardia związana z niedoborem nośnika norepinefryny cd

U matki i całego rodzeństwa, z wyjątkiem jednej siostry, ciśnienie krwi i częstość akcji serca określano w pozycji leżącej na plecach i po 5 minutach odstawienia, a katecholaminy w osoczu mierzono po tym, jak badani byli w pozycji leżącej przez 20 minut, a następnie po stojąc przez 30 minut. Wykrywanie mutacji
Amplifikację i sekwencjonowanie przeprowadzono w Vanderbilt Center for Molecular Neuroscience DNA Sequencing Core. Genomowy DNA wyizolowano z krwi żylnej za pomocą zestawu do ekstrakcji DNA PureGene (Gentra Systems, Minneapolis), a eksony ludzkiego genu transportera norepinefryny (SLC6A2, McKusick nr 16397014) zamplifikowano za pomocą reakcji łańcuchowej polimerazy i sensu i startery antysensowne (sekwencje oligonukleotydów stosowanych w reakcji łańcuchowej eksonowej polimerazy i warunki amplifikacji są dostępne na żądanie). Zamplifikowane produkty (60 ng na próbkę) sekwencjonowano bezpośrednio za pomocą terminatorów łańcucha fluorescencyjnego dideoksynukleotydu (AmpliTaq FS, Perkin Elmer Applied Biosystems, Foster City, CA) na zautomatyzowanym sekwenatorze DNA (ABI 310, Perkin Elmer Applied Biosystems).
Analiza funkcjonalna zidentyfikowanej mutacji
DNA kodujący ludzki transporter norepinefryny alaniną zastąpioną przez prolinę w pozycji 457 (Ala457Pro) utworzono za pomocą zestawu (QuikChange Site-Directed Mutagenesis Kit, Stratagene, La Jolla, CA) z oligonukleotydami 5 CCTTCAGTACTTTCCTTCTCCCCCTGTTCTGCATAACCAAG3 i 5 CTTGGTTATGCAGAACAGGGGGAGAAGGAAAGTACTGA-AGG3 . Continue reading „Nietolerancja ortostatyczna i tachykardia związana z niedoborem nośnika norepinefryny cd”

Komórki cytokeratynowe w szpiku kostnym i przeżycie pacjentów z rakiem piersi w stadium I, II lub III czesc 4

Pierwszorzędowym punktem końcowym było przeżycie mierzone od daty operacji do czasu ostatniej wizyty kontrolnej lub śmierci związanej z rakiem. Drugorzędowymi punktami końcowymi były: nawrót lokoregionalny (w tym nawroty w piersiach ipsilateralnych i przeciwstronnych) oraz odległe przerzuty i były mierzone w taki sam sposób jak pierwotny punkt końcowy. Skonstruowaliśmy krzywe tablicowe Kaplan-Meier dla przeżycia wolnego od miejscowych i odległych nawrotów i całkowitego przeżycia.25 Użyliśmy testu log-rank do porównania pacjentów z mikroprzerzutami szpiku kostnego z tymi bez mikroprzerzutów. Dane dotyczące pacjentów, którzy żyli i nie mieli dowodów choroby pod koniec naszego badania, zostały ocenzurowane. Do oszacowania efektu prognostycznego różnych zmiennych wykorzystaliśmy analizę proporcjonalnego hazardu Coxa. Continue reading „Komórki cytokeratynowe w szpiku kostnym i przeżycie pacjentów z rakiem piersi w stadium I, II lub III czesc 4”

Indukowanie receptora insuliny przez hydrokortyzon w hodowlanych limfocytach (linia IM-9).

Hydrokortyzon zwiększa liczbę receptorów insuliny na powierzchni ludzkich hodowanych limfocytów (linia IM-9) bez zmiany degradacji dojrzałych podjednostek receptora. Aby wyjaśnić wpływ glikokortykosteroidów na biosyntezę receptora insuliny komórek IM-9, preinkubowaliśmy komórki w obecności lub nieobecności hydrokortyzonu (1,4 X 10 (-6) M) i mierzyliśmy wbudowywanie znakowanych radioaktywnie cukrów do receptora insuliny składniki. Od 6 do 22 h nastąpił postępujący wzrost inkorporacji [3H] mannozy do receptora insuliny (190 000 moli) i dojrzałych podjednostek (210 000, 135 000 i 95 000 moli). Ilość wprowadzona do komórek traktowanych hydrokortyzonem była zawsze trzy do czterech razy wyższa niż w komórkach kontrolnych, pomimo braku zmiany liczby komórek, żywotności lub radioaktywnej puli cukru. Aby bezpośrednio przetestować najwcześniejszy wpływ hydrokortyzonu, podjęliśmy badania nad pulsacją. Continue reading „Indukowanie receptora insuliny przez hydrokortyzon w hodowlanych limfocytach (linia IM-9).”

Zwiększona wrażliwość na insulinę i reakcja metabolizmu glukozy w adipocytach ze szczurów płci żeńskiej i męskiej.

Badanie to przeprowadzono w celu zbadania, czy istnieją zależne od płci różnice w działaniu insuliny na metabolizm glukozy w adipocytach. Wiązanie insuliny i krzywe dawka-odpowiedź dla transportu glukozy (oszacowane przez pomiar radioaktywności związanej z komórką po 15-godzinnej inkubacji z 50 mikroM [6-14C] glukozą) i metabolizmem [U-14C] glukozy (5 mM) do CO2 i Lipidy porównano w adipocytach zaotrzewnowych z dobranych pod względem wieku (84 d) samców i samic szczurów. Ponadto określono aktywność syntetazy kwasów tłuszczowych, jednego z kluczowych enzymów lipogennych. Wielkość komórek tłuszczowych nie była istotnie większa u kobiet niż u mężczyzn (0,238 vs. 0,259 mikrograma lipidu na komórkę). Continue reading „Zwiększona wrażliwość na insulinę i reakcja metabolizmu glukozy w adipocytach ze szczurów płci żeńskiej i męskiej.”

Estrogeny i antyestrogeny stymulują uwalnianie aktywności wchłaniania kości przez hodowane ludzkie komórki raka sutka.

U pacjentów z zaawansowanym rakiem piersi może wystąpić ostra, ciężka hiperkalcemia po leczeniu estrogenami lub antyestrogenami. W tym badaniu zbadaliśmy wpływ estrogenów i związków pokrewnych na uwalnianie aktywności wchłaniania kości przez hodowane komórki ludzkiego raka sutka in vitro. Stwierdziliśmy, że linia komórkowa MCF-7 z receptorem estrogenu na raka sutka uwalnia aktywność resorpcyjną kości w odpowiedzi na niskie stężenia 17 beta-estradiolu. Aktywność resorpcji kości została również uwolniona w odpowiedzi na antyestrogen nafoksydynę. Inne związki steroidowe nie miały wpływu na uwalnianie aktywności resorpcyjnej kości. Continue reading „Estrogeny i antyestrogeny stymulują uwalnianie aktywności wchłaniania kości przez hodowane ludzkie komórki raka sutka.”

Interakcja czynnika asialo von Willebranda z glikoproteiną Ib indukuje wiązanie fibrynogenu z kompleksem glikoproteiny IIb / IIIa i pośredniczy w agregacji płytek.

Czynnik von Willebranda (vWF) jest niezbędny do początkowego przyłączenia płytek krwi do odsłoniętego podśródbłonka, szczególnie w warunkach przepływu, takich jak te panujące w mikrokrążeniu. Niewiele wiadomo o jego możliwym udziale w kolejnych zdarzeniach prowadzących do powstania skrzeplin płytek krwi w miejscach uszkodzenia naczyń. Odpowiedzieliśmy na to pytanie, badając mechanizmy, dzięki którym desialilowany vWF indukuje agregację płytek krwi przy braku jakiegokolwiek innego bodźca. Asialo vWF, w przeciwieństwie do natywnej cząsteczki, nie wymaga ristocetyny do interakcji z płytkami krwi. Aglutynacja wywołana ristocetyną jest w dużej mierze niezależna od aktywnego metabolizmu płytek krwi i tylko częściowo odzwierciedla zdarzenia fizjologiczne. Continue reading „Interakcja czynnika asialo von Willebranda z glikoproteiną Ib indukuje wiązanie fibrynogenu z kompleksem glikoproteiny IIb / IIIa i pośredniczy w agregacji płytek.”

Przeciwciała płytek krwi klasy IgM w immunologicznej plamie małopłytkowej.

Przebieg kliniczny i odpowiedź na leczenie pacjentów z immunologiczną plamicą małopłytkową (ITP) nie są całkowicie określone przez poziom IgG obecnych na powierzchni płytek krwi. Jest możliwe, że przeciwciała z innych klas immunoglobulin także odgrywają rolę w niszczeniu płytek krwi u niektórych z tych pacjentów. Dlatego też zbadaliśmy 175 pacjentów z ITP pod kątem obecności przeciwciał IgM przeciw płytkom krwi za pomocą radioznakowanego przeciwciała poliklonalnego lub monoklonalnego anty-IgM. Zaobserwowaliśmy, że 57% pacjentów z klinicznym ITP miało podwyższone poziomy IgM na ich płytkach krwi, w porównaniu z normalnymi kontrolami i pacjentami z trombocytopenią, którzy nie mieli ITP (mniej niż 10%), (P mniej niż 0,01). Uzyskaliśmy podobne wyniki, stosując radioznakowane poliklonalne lub monoklonalne anty-IgM, odczynniki, których integralność najpierw scharakteryzowano przy użyciu erytrocytów pokrytych określoną ilością przeciwciała IgM. Continue reading „Przeciwciała płytek krwi klasy IgM w immunologicznej plamie małopłytkowej.”