Wczesne wyrażanie czynników angiogenezy w ostrym niedokrwieniu mięśnia sercowego i zawale cd

Fragmenty zamrożonych próbek liofilizowano, a następnie RNA ekstrahowano kwaśną techniką tiocyjanian-fenol-chloroform guanidyny, jak opisano wcześniej. Odzyskany osad RNA suszono w warunkach próżniowych przez 10 do 15 minut, a następnie rozpuszczano w dejonizowanej wodzie destylowanej potraktowanej piro- węglanem dietylu. Stężenie i czystość RNA określono przez analizę spektrofotometryczną (Ultrospec II, Biochrom, Cambridge, Anglia) przy 260 i 280 nm. Próbki przechowywano w -80 ° C do czasu analizy.
Pomiar RNA
Zastosowano reakcję łańcuchową polimerazy z odwrotną transkryptazą (PCR) w celu analizy każdej próbki komorowej pod kątem obecności transkryptów kodujących HIF-1., HIF-1., VEGF i cyklofilinę. MRNA cyklofiliny badano jako marker kontrolujący zmienność stężenia RNA i degradację RNA jako potencjalne zmienne zakłócające. Pięć mikrogramów całkowitego RNA użyto do syntezy komplementarnego DNA (cDNA) za pomocą odwrotnej transkryptazy Super Script II i oligo (dT) 12-18 (GIBCO BRL, Gaithersburg, MD). Zsyntetyzowane startery miały następujące sekwencje: dla HIF-1., 5 CTGTGATGAGGCTTACCATCAGC3 i 5 CTCGGCTAGTTAGGGTACACTTC3 ; dla HIF-1., 5 CAGGTCGGATGATGAGCAGAGCA3 i 5 CTCATGGAAGACTGCTGACCTTC3 ; dla VEGF, 5 GGATGTCTATCAGCGCAGCTAC3 i 5 TCACCGCCTCGGCTTGTCACATC3 ; i dla cyklofiliny, 5 GTGACTTCACACGCCATAATGGC3 i 5 GGTGCTCTCCTGAGCTACAGAAGG3 .
Zduplikowane reakcje amplifikacji przeprowadzono z jednoblokowym termocyklerem (Ericomp, San Diego, CA) zawierającym 2 .l pierwszej nici cDNA, .l każdego startera, trójfosforany deoksynukleotydowe (po 10 .M każdy), 25 mM chlorek magnezu, 0,5 U polimerazy DNA Taq i 36,5 .l autoklawowanej wody destylowanej. Każda próbka podlegała początkowej denaturacji w temperaturze 95 ° C przez 5 minut, 35 cykli denaturacji w temperaturze 95 ° C przez 30 sekund, hybrydyzacji w temperaturze 55 ° C przez minutę, wydłużaniu w temperaturze 72 ° C przez minutę i końcowemu wydłużeniu w 72 ° C. C przez 10 minut. Produkty PCR poddano elektroforezie na 1,8% żelach agarozowych zawierających 3% bromku etydyny w buforze octan-EDTA z TRIS. Żele sfotografowano za pomocą aparatu do fotofotografii elektroforezy (Fisher Scientific, Pittsburgh) na czarno-białym filmie (3000ISO, Polaroid, Cambridge, Mass.).
Barwienie immunohistochemiczne dla HIF-1. i VEGF
Fragmenty zamrożonych próbek biopsyjnych utrwalono w 10% formalinie i przygotowano jako wycinki tkanek o grubości 5 .m. Następnie parafinę usunięto za pomocą substytutu ksylenu (Hemo-De, Fisher Scientific) i skrawki ponownie uwodniono za pomocą przemywania etanolem. Skrawki uszkodzonej tkanki i zdrowej tkanki od pacjentów z niedokrwieniem lub zawałem i skrawki od pacjentów bez niedokrwienia lub zawału inkubowano z mysimi antyludzkimi HIF-1. IgG (IgG2v, Novus Biological, Littleton, Colo.) Lub mysimi antyludzkimi VEGF IgG ( IgG2a, Santa Cruz Biotechnology, Santa Cruz, CA) w rozcieńczeniu 1: 100. Kontrolne sekcje inkubowano z rozcieńczoną normalną surowicą końską (Vector Laboratories, Burlingame, CA) zamiast pierwotnego przeciwciała. Wszystkie sekcje inkubowano następnie z biotynylowanymi drugorzędowymi przeciwciałami antymodowymi i barwiono techniką immunoperoksydazy (odczynniki Vectastain Elite ABC, Vector Laboratories)
[hasła pokrewne: opukiwanie płuc, szmery oddechowe, idiosynkrazja ]
[podobne: blok serca, fizjologia cmuj, ból krtani ]